For the Man of Tomorrow
Four Poems by Rocco Valentini
Artwork Sourced From Pinterest. Artist: Hajime Sorayama.
1. The Non-Fungible Soul
by Antonio Rocco S. (Rocco Valentini)
Even if we gave it the benefit of the doubt
And said that heaven is real,
It's irrelevant since none of us will personally go there.
Human consciousness is a non-fungible,
Machine-bound software.
Once the body is gone, so is the ego.
01001100 01101001 01100110 01100101
Replication is not transition—
It's replacement.
A spirit in the afterlife
Or an AI in a computer
Would be a clone,
And that clone would represent a new "I."
01001100 01101001 01100110 01100101
The entity being uploaded to heaven by God
Or to the cloud by a programmer
Is not you
Because you are defined by your choices
And by your agency,
Not by your experience or data.
01001100 01101001 01100110 01100101
You are working towards someone else's salvation.
You do not go to heaven.
A copy of you goes to heaven.
A gallery full of copies is not a museum—it’s a mausoleum.
Exist for the world—
Because the world is the only place you'll ever exist.
01001100 01101001 01100110 01100101
It is better to die with authorship
Than to surrender your legacy to a ghostwriter.
When your pen runs out of ink, your book closes.
Perhaps that's what banishment from heaven is—
A closed book.
Perhaps damnation simply means deletion of consciousness.
01001100 01101001 01100110 01100101
Perhaps the Luciferian position is the humanist position—
A final assertion of selfhood.
Maybe hell is for the virtuous.
Footnote: 01001100 01101001 01100110 01100101 is binary code for Life.
Artwork Sourced From Pinterest. Artist: Roger Dean.
2. The Halting Problem
by Antonio Rocco S. (Rocco Valentini)
Human consciousness has a halting problem. The halting problem asks Whether it is possible to determine If a program will eventually stop running Or If it will continue to run indefinitely. 01000100 01110010 01100101 01100001 01101101 What happens to us when we die? Death appears to be the “halt,” Yet from a first-person perspective, There may never be a moment At which non-existence is experienced By the subject. 01000100 01110010 01100101 01100001 01101101 Consciousness isn't aware Of its own absence— It's only aware of itself. Can we ever truly know if, Or when, The stream of subjective experience ends? 01000100 01110010 01100101 01100001 01101101 Death may be the moment The mind dreams itself Into eternity. 01000100 01110010 01100101 01100001 01101101 Consider the time dilation that occurs during sleep. While dreaming, we sometimes perceive Time as passing much more slowly Than it does in the real world. What feels like months of activity in a dream Is in reality just a few minutes of REM sleep. 01000100 01110010 01100101 01100001 01101101 Could it be that, In our final dream— As the brain deteriorates post-mortem— We experience what seems like Years, decades, centuries, Or even millennia of a subjective afterlife? 01000100 01110010 01100101 01100001 01101101 Could we become necronauts— Explorers of death— Who experience a subjective eternity In a solipsistic, Dalí-esque world Where melting clocks cannot measure time? 01000100 01110010 01100101 01100001 01101101 God does not punish or reward us in death, Our egos do. You are the judge, jury and executioner of your soul. Footnote: 01000100 01110010 01100101 01100001 01101101 is binary code for Dream.
Artwork Sourced From Pinterest. Artist: Norman Saunders
3. The New Cold War
by Antonio Rocco S. (Rocco Valentini)
A womb is a silo,
And procreation, like a missile launch,
Once required two hearts to turn the key.
ATGGTGCACCTGACTCCTGA
But what happens
When procreation requires
Neither key nor silo?
ATGGTGCACCTGACTCCTGA
What happens
When a person or organization
Is handed the big red button?
ATGGTGCACCTGACTCCTGA
Once, we feared mushroom clouds.
Tomorrow, we may fear glass wombs.
ATGGTGCACCTGACTCCTGA
As we edge closer
To a future where humans
Can be bred in glass tubes,
We must consider what safeguards are needed
To avoid a new kind
Of mutually assured destruction.
ATGGTGCACCTGACTCCTGA
There are those
Who wish to replace the missile silo
With the grain silo.
ATGGTGCACCTGACTCCTGA
They wish to grow people
As if they were crops
To be harvested.
ATGGTGCACCTGACTCCTGA
A cloned or genetically modified human
Is still a human—
And humans have rights.
ATGGTGCACCTGACTCCTGA
A person is not a product
Regardless of whether
They're homegrown or GMO.
ATGGTGCACCTGACTCCTGA
Perhaps two keys are better than one button.
Maybe marriage is a security clearance.
Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.
Artwork Sourced From Pinterest. Artist: Barry Godber.
4. One Flesh
by Antonio Rocco S. (Rocco Valentini)
If marriage is the joining of two into one flesh,
Then marriage without compatibility
Is a failed skin graft.
ATGGTGCACCTGACTCCTGA
When companionship lacks compatibility,
It withers from necrosis.
It's impossible to hold onto the idea of love
When your fingers are rotting away.
ATGGTGCACCTGACTCCTGA
Sometimes, the DNA of a marriage
Requires gene therapy.
You have to replace the rungs
Of a broken ladder
And engineer your relationship for success.
ATGGTGCACCTGACTCCTGA
Other times you have to cut off
The ring finger
To preserve the hand.
ATGGTGCACCTGACTCCTGA
A successful marriage is one
In which two individuals
Mutually benefit from one another—
A symbiosis of souls.
ATGGTGCACCTGACTCCTGA
When love is more than just skin deep...Can you survive the graft?
Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.