Cover Art by Eric Harper
Hardboiled Heart Collection
Includes 25 poems.
A hardboiled heart is a romantic realist; it doesn't fake reality—it stylizes it. — Antonio Rocco S. (Rocco Valentini)
Chapter 1. Noir
Artwork Sourced From Pinterest. Artist: Fabian Perez.
1. Hardboiled
by Antonio Rocco S. (Rocco Valentini)
What the history of the world teaches Is that universal brotherhood is not real It is the philosophy the farmer preaches To the ox who plows his fields. Ignore the conventions and taboos, Behind every smile there's teeth. Don't let them bare down on you Be not the prey but the predator who eats. As a man in a battered felt watches the cannibals He feels an unsubtle rage Toward men he sees as nothing but animals Domesticated beasts who won't leave their cage. Traversing rain-soaked alleys in a trench coat A sense of foreboding lingers— A feeling his face cannot emote He is determined still to point the finger. He takes his reality neat like his whiskey And his speech unfiltered like his cigars. He knows taking anything on the rocks is risky And that even a white lie can leave a nasty scar. There can be no prohibition of truth Illusion has no place at a speakeasy's table. A martini cannot be made without vermouth And bottles must never be left without labels. He knows that life is not roulette No fortune is won in a game of craps. Greatness is not a sum paid for a bet Every success story has a map. He cannot pray for a revelation Nor for a dame to fall into his lap. He must rise to meet expectations And earn that feather in his cap. Between a suit vest and a Kevlar vest Hangs a pair of suspenders with a holster. A private detective moves at the behest Of his own judgment, not that of pollsters. Although the system is pathologic He measures the world by rise over run Understanding that ethics are ruled by logic While the law is just an opinion backed by a gun.
Artwork Sourced From Pinterest. Artist: Unknown.
2. Rain
by Antonio Rocco S. (Rocco Valentini)
Rain falls like morse code tapping the Earth.
.-. / .- / .. / -.
Cars with white ovals in their windows
Flash past you on the street.
Puddles on the sidewalk below
Mirror the sky’s uncertainty at your feet.
.-. / .- / .. / -.
Rain washes away the resolve
That the sun once tried to instill.
Apathy is a hard problem to solve
Alleys teach lessons classrooms never will.
.-. / .- / .. / -.
Graffiti is a city’s diary, it tells a story—
A story of social decay.
Every underbelly has its inventory
Not all bean counters work in cafés.
.-. / .- / .. / -.
In a world where purpose is said to be derived from pain
Romance is realism with its collar turned up against the rain.
Pluie du matin n’arrête pas le pèlerin.
(Translation: Morning rain doesn't stop the pilgrim.)
Footnote: .-. / .- / .. / -. spells RAIN in Morse Code.
3. The Shadow
by Antonio Rocco S. (Rocco Valentini)
Justice in a courtroom is theater Justice on the street is consequence. The law bends But a moral spine should not. When facing murderers, rapists, drug dealers Corrupt politicians, and corporate embezzlers Doing things by the book means Having your name removed from the yellow pages. Good, like light, changes shape When confronted by darkness. Light’s shadow is good’s resilience. The brim of a pulp adventurer’s fedora Casts a shadow over the wicked In a way a comic book hero's cape cannot. Morality isn't something you find In a Saturday morning cartoon Or in a display case for twenty-five cents. Morality is a shadow that grows In proportion to the evil it confronts.
Artwork Sourced From Pinterest. Artist: George Rozen.
4. The Comedian
by Antonio Rocco S. (Rocco Valentini)
The comedian is a clown Whose nose is a pomander And whose circus tent Is a fumigation tarp Filled with laughing gas. N₂O The comedian is not an apothecary He is a mortician. Irony is formaldehyde In a world dying from a lack of sincerity. The punchline is the time of death. N₂O "Lighten up." "Life’s too short to be serious all the time." "Learn to laugh at yourself." Laughter is the final sickening crack of the soul In a noose pulled tightly by a smile. N₂O Perhaps if more people died laughing The rest might learn to live by thinking. No more Día de los Muertos No more Memento Mori— Memento te vivere debere. (Translation: No more Day of the Dead, no more remembering that you must die—remember that you must live.) Footnote: N₂O is the chemical formula for nitrous oxide, commonly known as laughing gas.
Artwork Sourced From Google. Artist: Norm Saunders.
5. Chicago Typewriter
by Antonio Rocco S. (Rocco Valentini)
ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ Ｄｉｎｇ． ↵ Every keystroke of the typewriter Hammers another nail Into the coffin of public memory. Every headline is a headstone. Every byline is occupied by a hitman. ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ Ｄｉｎｇ． ↵ Truth never makes the morning edition It shows up later As a chalk outline in the editor’s column A body of work riddled with lies Cut down by the Chicago typewriter Of a crooked journalist Whose sentences spill more blood Than bullets ever could. ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ Ｄｉｎｇ． ↵ By the time truth hits the print The blood has already dried. The Overton Window Is what forms when it clots. Only then do the coroners Who call themselves “critical thinkers” Arrive to sift through the guts of a problem They never had any intention of solving. ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ Ｄｉｎｇ． ↵ The average person's mind Is a collection Of platitudes and contradictions Dumped on them by their newsstand. Each time this landfill Accumulates enough trash To form a new layer They call it "personal growth". ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ ⓒⓛⓐⓒⓚ Ｄｉｎｇ． ↵ The typewriter's bell is a flatline It is the last breath of truth Struggling to escape Before the page is torn out Forgotten.
Artwork Sourced From Pinterest. Artist: Edward Hopper.
6. Fast Food for Thought
by Antonio Rocco S. (Rocco Valentini)
Art is nutrition for the mind And our culture has an eating disorder. The anemia has left us blind And the heights we reach grow shorter. Nourishment is needed to make the body strong But the mind’s dietary plan must be rethought. Won’t someone with a refined palate come along And offer more than just fast food for thought? Self-help, harlequin and slice of life Why is this all that’s ever on the menu? No one dares to cut the fat out with a knife The head chefs are barred from every venue. Writers dip their quills in the inkwell of the world And from their pages others' words silently seep. By the masses their mediocrity is rarely unfurled They muddy the water to make it seem deep. Who would place Michelangelo beside Warhol? Would you pair a fine steak with a cheap wine? Why must the industry exalt it all? Why must the mediocre taint the sublime? Picasso said good artists copy; great ones steal. Hacks claim there’s nothing new under the sun. As a result our filmmakers have run out of reel And our comedians have run out of puns. Our ideas shrink like microwaved leftovers Collapsing in on themselves—rubbery and bland. This year’s debut album swept over A cover of last year’s band. We praise mumble rappers in garrish bling And lyricists whose words are hieroglyphs. Must a bassist hang himself by his string Just so he can sell his riffs? Don't be afraid to be a bard in a peanut gallery A critic in a box seat may earn a higher salary But the code of competence is the golden rule A democracy of geniuses beats a dynasty of fools. From the ashes of the public arises A torchbearer carrying the spark of reason One whose vision allows no compromises Yet serves as a feast for vultures—a Promethean.
Artwork Sourced From Pinterest. Artist: Unknown.
7. Unsolved Homicide
by Antonio Rocco S. (Rocco Valentini)
No eyes return to the case file. No hands reach out for new evidence. What killed the American Dream? ONE-EIGHT-SEVEN Once red lights flashed Across tracks that carried us Toward new horizons. Now America's future rolls away In foreign boxcars As politicians punch tickets Like train conductors Their rhetoric roaring like engines Shuttling our nation Down a steel track toward oblivion. ONE-EIGHT-SEVEN Once a single wage Built a home for many Now it hardly shelters one. A white picket fence On a suburban lawn Now only a curtain pulled tight In a studio apartment Where walls shrink And dreams downsize. ONE-EIGHT-SEVEN Who printed our obituary? Was our death certificate signed With the same ink the Fed uses to print money? ONE-EIGHT-SEVEN What killed the American Dream? Footnote: ONE-EIGHT-SEVEN is police code for homicide.
Artwork Sourced From Pinterest. Artist: Jim Steranko.
8. Fire Code
by Antonio Rocco S. (Rocco Valentini)
TEN-SEVENTY Sigmas do not exist Because power does not lie In what you call yourself It lies in what others believe you hold. TEN-SEVENTY Rejecting the social hierarchy Doesn’t change your position in it Nor does it change Your influence over it. TEN-SEVENTY Obscurity rebranded Is still irrelevance. The world doesn’t bend For those who simply step aside. TEN-SEVENTY In a society likened to a burning building He who watches the blaze without lifting a hand Stands not with the hero But with the arsonist. TEN-SEVENTY Stand before the ruin or above it But never beneath or beside it. Be the Alpha who prevents the fall Or who rises like it never broke him. Footnote: TEN-SEVENTY is police code for fire.
Artwork Sourced from Pinterest. Artist: Chris Consani.
9. The Phantom Limb
by Antonio Rocco S. (Rocco Valentini)
The mind is the phantom limb of the brain And emotions are the reflex hammer of the mind They are the mechanism for pleasure and pain Allowing our values and senses to be intertwined. Thought without feeling is a road without traction The strength of one’s grip comes from conviction. Emotions let us feel the weight of abstractions They prevent us from sliding without restriction. The mind is a vehicle driven by the will of man His heart the motor that travels across the land. He must refuel at the station whenever he can To regain his strength as his spirit rests its hands.
Artwork Sourced From Pinterest. Artist: Unknown
10. You’re My Thrill
by Antonio Rocco S. (Rocco Valentini)
𝄞 Jazz begins with a rhythm
and becomes an improvisation.
𝄞 Jazz is proof
that order can fall in love with chaos.
“You’re my thrill...”
She’s sitting in her office,
Leaning back in her chair
Stilettos propped on her desk.
She has two magnums on her desk.
One’s a .44 she keeps loaded.
The other’s a bottle—
It keeps her loaded.
I stand in her doorway
And she tells me
“It’s pointless to try drowning your sorrows
In a river of whiskey
—They’ll just learn to swim.”
“You do something to me...”
A cigarette dangles
From the corner of her mouth
Her red lipstick matches the neon sign
Bleeding through the blinds.
She crooks her finger and I come in.
She tells me about her troubles,
Leaning in close
Her breath is hot on my ear
But her words are cold.
Life has thrown her punches
But she’s no coward—
The only thing that runs are her nylons.
“You send chills right through me...”
She’s a musician at the local nightclub.
She’s still wearing her dress from tonight’s performance
And if all goes well for me
She’ll still be wearing it tomorrow morning.
Her body type?
An hourglass with a few extra minutes.
And I certainly don’t mind the wait.
I like my women
The way I like my coffee and cigarettes—
Black and full-bodied.
My fingers long to dance across her white blouse
Like a pianist over ivory keys.
“When I look at you ‘cause you’re my thrill...”
𝄞 Love begins with a rhythm
and becomes an improvisation.
𝄞 Love is proof
that the heart has its own sheet music.
Footnote: Lyrics in quotation sourced from “You’re My Thrill” by Billie Holiday.Chapter 2. Heart of the Sea
Artwork Sourced from Pinterest. Artist: Unknown.
11. Braille
by Antonio Rocco S. (Rocco Valentini)
She's an ebony hourglass that walks the sand
In a white linen dress as sheer as her soul.
She whispers secrets to the waves,
Secrets washed away,
Along with the traces of her soles.
The cool of the ocean breeze
Gives her goosebumps
That rise on her skin like verses
And my hands long to read her body
As if it were a poem written in Braille.
⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊
Women with full figures
Hold deep truths
And sometimes the truth
Is too deep
For water that is shallow.
We exchange minds
As effortlessly as the wind
Trades grains of sand
And her smile is like aloe vera
For my sunburned soul.
⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊
Like the Queen of Sheba,
She questions my manhood
With a gaze as sharp as her wit,
Laying me down
On a dune by the shore.
The white linen dress
Now draped around her ankles
Is not a flag of surrender,
It is a banner,
And I kneel beneath it.
⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊
Beneath her, I tremble,
She steadies me with her hands,
Her voice,
Her weight.
Between exhausted sighs
And beads of sweat mingling with saltwater,
I come to the realization that I am hers.
I kiss her seal
And rise, not a king or prince,
But her devoted subject.
⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊
I move into her castle and discover the hallway
Lined with portraits of her former lovers.
Other men had clung to her flesh,
But never to her spirit.
They had been jesters in her court,
They had entertained her;
She had played with their bells,
They had entered her many times,
But their names were never written on her
As mine is, in Braille.
የእርስዋ እጅ ያውረዳል፤ የእርስዋም ልብ አይራራም
(Translation: Her hand may falter, but her heart does not waver.)
Footnote: ⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊ is Braille for Rocco Valentini.
Artwork Sourced From Pinterest. Artist: Unknown.
12. Payal
by Antonio Rocco S. (Rocco Valentini)
o——ॐ——o
प्यार एक ताले और चाबी के रिश्ते की तरह है।
Love is a lock-and-key relationship.
o——ॐ——o
चिंक चिंक चिंक
Moonlight
Slices through the window
Of our bedroom like a Katar.
She enters
And I hear the clinking
With each heartbeat.
Her bare foot rests on my lap,
And the chain around her ankle
Reminds me I do not own her—
She owns me.
o——ॐ——o
चिंक चिंक चिंक
Her payal is an alambana
Its charms all have silver tongues
And speak before she does,
Persuading me
To hand them
The key to my cage—
To see if a Tyger
Can change its stripes
Or
If it will be bound by them.
o——ॐ——o
चिंक चिंक चिंक
I am a prisoner of desire
And she is the warden
Who holds the key to my heart.
She rides me like Durga rides her Tyger,
Taming the wild within my spirit
And inspiring a fearful symmetry
In the eye of my passion.
The act of being mounted
Transforms my lust for her
Into something divine.
o——ॐ——o
प्यार एक विरोधाभास है जहां गुलाम भी स्वामी होता है।
Love is a paradox where the slave is also the sovereign.
Artwork Sourced From Pinterest. Artist: Unknown.
13. Guayabera
by Antonio Rocco S. (Rocco Valentini)
It’s a hot day. The Earth exhales, Its breath thick with sun. Beneath my Panama hat, I see waves of heat Rippling like the embroidery On my guayabera. Veo olas de calor Ondulando como el bordado De mi guayabera. ≋≋≋≋≋≋≋≋≋≋≋≋ I spot her by the cabana. Her eyes are like ports To a cool island oasis, I long to take the ferry to her soul And chart a topographical map Of her body. Anhelo tomar el ferry hacia su alma Y trazar un mapa topográfico De su cuerpo. ≋≋≋≋≋≋≋≋≋≋≋≋ I approach her and journey on Through peaks of conversation And valleys of silence Until night falls upon us. The moon is like a skilled metallurgist, Forging a sea of silver beneath its light, Illuminating her raven hair and bronze skin. La luna es como un hábil metalúrgico, Forjando un mar de plata bajo su luz, Iluminando su cabello de cuervo y su piel de bronce. ≋≋≋≋≋≋≋≋≋≋≋≋ Lust opened the door. Love guided me through it. Loyalty closed it behind us. Now we live together In our own private paradise. Like the guayabera Love carries in its pockets What the heart cannot wear on its sleeve. Como la guayabera El amor lleva en sus bolsillos Lo que el corazón no puede llevar en la manga.
Artwork Sourced From Pinterest. Artist: Unknown.
14. Sex is Not a Performance Art
by Antonio Rocco S. (Rocco Valentini)
Sex is not a performance art It is not Cirque du Soleil. You cannot film the beat of two hearts And turn their rhythm into a public display. Love cannot be captured in a photograph It cannot be performed on stage. A heart's content cannot be detected on a sonograph Intimacy should never be confined to a glass cage. Sex is the form that love embodies And its practice should never be maligned. However overeating leaves stretch marks on the body And casual sex leaves stretch marks on the mind. Love is seeing someone's mind as your scripture. Lust is seeing someone's body as your church. In a loving relationship sex must be a fixture— Love without sex is like faith without works.
Artwork Sourced from Pinterest. Artist: David Grove.
15. The Mariner
by Antonio Rocco S. (Rocco Valentini)
In today’s sea of discourse it’s easy to get seasick It feels like you’re a carpenter in a ship’s hull With a hole expanding under pressure so quick It threatens to drown the contents of your skull. You’re a seafaring Sisyphus, a maritime martyr, Bailing out the whirlpool of Poseidon’s throne, Struggling to keep your tricorn from becoming a marker For an underwater tombstone. The currents carry you toward your final release Your body to be marooned in the coral reef You have a single shot in your musket, But rather than turning it on yourself, Take aim at the pallbearer’s mitts, And free yourself from his nautical cartel. Don’t seal your will in a bottle and cast it ashore Make your final stand against the tide. Drop your anchor to the ocean floor And let Davy Jones decide. To your greatest fears you must never succumb You needn’t outrun the fates you need only run out the rum.
Chapter 3. Frontiers
Artwork Sourced from Pinterest. Artist: Norman Saunders.
16. Lone Star
by Antonio Rocco S. (Rocco Valentini)
Sharp minds wear hard faces Strong arms bear calloused hands. Both are examples of the traces Left by the spirit of a great man. A great man is no grave robber He doesn't stake his reputation on dead kin. Be a man of integrity and honor For your birth is where your frontier begins. Don’t abandon your part Resist the call of the sirens. Never trade your ace of hearts For an ace of diamonds. Even if you ride as a lone ranger Never throw away your star For you are always in danger From desperados bearing their own scars. There will never be peace Crooked men must learn their lesson. Iniquity will only ever cease When you draw your Smith & Wesson. There is nothing beyond this town No heaven or hell—death is a desert of night. Don’t let desperados turn your town Into a desert of daylight.
Artwork Sourced from Pinterest. Artist: Unknown.
17. Western Ronin
by Antonio Rocco S. (Rocco Valentini)
武士道 勇 Ride alone across the open prairie And let your spurs be caked with mud A testament to the burdens you carry 義 Your duster stained with blood. 名誉 A life without honor brings endless strife As does a death without purpose For chivalry is the poetry of life 忠義 And to your ideals you pledge your service. 仁 Bend like a reed that sways in the wind Yet stand firm like a rock against the tide Strike forward until your enemies rescind 礼 Such is the way of the samurai. 誠) The Western Ronin carries seven virtues and a six shooter.
Artwork Sourced From Pinterest. Artist: Unknown.
18. Amber
by Antonio Rocco S. (Rocco Valentini)
Dawn bleeds over the Mojave
As a raven circles overhead.
A sandstorm—
Large enough to bury Ozymandias—
Approaches a lone rider
As ancient as the desert he explores.
His obituary is written by Thoth
In hieroglyphs.
𓄿 𓅓 𓃀 𓂋
The old man sags in his saddle,
His face as leathery as his boots,
His joints as loud as his spurs.
Yet his vision endures,
Despite the cataracts.
His soul remains untouched by time,
Bottled in amber—
Like the whiskey he drinks.
𓄿 𓅓 𓃀 𓂋
A relic with a revolver,
The scent of gunpowder clings to him,
Like a Ka that never left.
He doesn’t hesitate to pull the trigger,
Though he’s no longer quick on the draw.
Even as the gunslinger’s gait
Slows to a geriatric shuffle,
The cowboy never forgets the trail.
𓄿 𓅓 𓃀 𓂋
His sun-bleached hat is like an Ankh.
The desert doesn’t bury legends—
It simply waits for them to retire—
But they never do,
Not until the sand covers them.
And when that sand turns to glass
You can still see it—
The amber of their soul.
الطبيعة لازم تاخد الراجل العظيم وهو نايم،
معندهاش القوة تاخده وهو صاحي.
(Translation: Nature must take the great man while he’s asleep, it does not have the strength to take him while he’s awake.)
Footnote: 𓄿 𓅓 𓃀 𓂋 is an Egyptian hieroglyph that roughly translates to amber. 
Artwork Sourced From Pinterest. Artist: Roger Dean.
19. The Halting Problem
by Antonio Rocco S. (Rocco Valentini)
Human consciousness has a halting problem.
The halting problem asks
Whether it is possible to determine
If a program will eventually stop running
Or
If it will continue to run indefinitely.
01000100 01110010 01100101 01100001 01101101
What happens to us when we die?
Death appears to be the “halt,”
Yet from a first-person perspective,
There may never be a moment
At which non-existence is experienced
By the subject.
01000100 01110010 01100101 01100001 01101101
Consciousness isn’t aware
Of its own absence—
It’s only aware of itself.
Can we ever truly know if,
Or when,
The stream of subjective experience ends?
01000100 01110010 01100101 01100001 01101101
Death may be the moment
The mind dreams itself
Into eternity.
01000100 01110010 01100101 01100001 01101101
Consider the time dilation that occurs during sleep.
While dreaming, we sometimes perceive
Time as passing much more slowly
Than it does in the real world.
What feels like months of activity in a dream
Is in reality just a few minutes of REM sleep.
01000100 01110010 01100101 01100001 01101101
Could it be that,
In our final dream—
As the brain deteriorates post-mortem—
We experience what seems like
Years, decades, centuries,
Or even millennia of a subjective afterlife?
01000100 01110010 01100101 01100001 01101101
Could we become necronauts—
Explorers of death—
Who experience a subjective eternity
In a solipsistic,
Dalí-esque world
Where melting clocks cannot measure time?
01000100 01110010 01100101 01100001 01101101
God does not punish or reward us in death,
Our egos do.
You are the judge, jury and executioner of your soul.
Footnote: 01000100 01110010 01100101 01100001 01101101 is binary code for Dream.
Artwork Sourced From Pinterest. Artist: Eugène Delacroix.
20. Gardens of Versailles
by Antonio Rocco S. (Rocco Valentini)
La politique est comme un pesticide qui empoisonne les droits naturels. (Translation: Politics is like a pesticide that poisons natural rights.) C₁₄H₉Cl₅ Should the tree have its branches bound Or its trunk cut down For the sake of the acorn on the ground? Is a fetus a baby before it crowns? Should every leaf, like a ballot, Be cast away To appease those with a different palate? Can the collective carry the individual away? C₁₄H₉Cl₅ Should the shade of a forest Serve as cover For the schemes of an unscrupulous florist? Should the politician come before the mother? Society is an arboretum And rights are the roots that let us grow. We can't let them uproot our freedom The way they already overturned Roe. C₁₄H₉Cl₅ In politics, there are many mouths that speak, But very few heads that think. From the guillotine, their blood must leak, So that the tree of liberty may drink. For the Parisian in revolution is to the Frenchman What the Athenian was to the Greek with gray hair. We are republicans, not monarchists’ henchmen, And to tyrants we must cry “Laissez-faire!” L’arbre ne tombe pas du premier coup. (Translation: The tree doesn’t fall with the first blow.) Footnote: C₁₄H₉Cl₅ is the chemical formula for DDT—dichlorodiphenyltrichloroethane—a common pesticide.
Artwork Sourced From Pinterest. Artist: Emanuel Leutze.
21. SEVENTY-SIX
by Antonio Rocco S. (Rocco Valentini)
The emperor is naked, Few mouth the content of their eyes By their countrymen they are forsaken— Truth is treason in an empire of lies. “We hold these truths to be self-evident...” History’s lantern lights the way, Yet many still choose the dark. Paul Revere does not ride by day— Tyranny employs its narcs. “That all men are created equal...” It is better to be a heretic among thinkers Than a saint among fools. The signature in Philadelphia lingers On the hearts of those misruled. “And are endowed with certain unalienable rights...” Ideas march further than armies ever will. America’s revolution was reason’s revenge— Taking all that philosophers like Locke had instilled And injecting it into the British with a lethal syringe. “Among these are Life, Liberty and the Pursuit of Happiness...” We the People of the United States Are Free As long as we are children who say what we see.
Artwork Sourced From Pinterest. Artist: Norman Saunders
22. The New Cold War
by Antonio Rocco S. (Rocco Valentini)
A womb is a silo,
And procreation, like a missile launch,
Once required two hearts to turn the key.
ATGGTGCACCTGACTCCTGA
But what happens
When procreation requires
Neither key nor silo?
ATGGTGCACCTGACTCCTGA
What happens
When a person or organization
Is handed the big red button?
ATGGTGCACCTGACTCCTGA
Once, we feared mushroom clouds.
Tomorrow, we may fear glass wombs.
ATGGTGCACCTGACTCCTGA
As we edge closer
To a future where humans
Can be bred in glass tubes,
We must consider what safeguards are needed
To avoid a new kind
Of mutually assured destruction.
ATGGTGCACCTGACTCCTGA
There are those
Who wish to replace the missile silo
With the grain silo.
ATGGTGCACCTGACTCCTGA
They wish to grow people
As if they were crops
To be harvested.
ATGGTGCACCTGACTCCTGA
A cloned or genetically modified human
Is still a human—
And humans have rights.
ATGGTGCACCTGACTCCTGA
A person is not a product
Regardless of whether
They're homegrown or GMO.
ATGGTGCACCTGACTCCTGA
Perhaps two keys are better than one button.
Maybe marriage is a security clearance.
Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.
Artwork Sourced From Pinterest. Artist: Barry Godber.
23. One Flesh
by Antonio Rocco S. (Rocco Valentini)
If marriage is the joining of two into one flesh,
Then marriage without compatibility
Is a failed skin graft.
ATGGTGCACCTGACTCCTGA
When companionship lacks compatibility,
It withers from necrosis.
It's impossible to hold onto the idea of love
When your fingers are rotting away.
ATGGTGCACCTGACTCCTGA
Sometimes, the DNA of a marriage
Requires gene therapy.
You have to replace the rungs
Of a broken ladder
And engineer your relationship for success.
ATGGTGCACCTGACTCCTGA
Other times you have to cut off
The ring finger
To preserve the hand.
ATGGTGCACCTGACTCCTGA
A successful marriage is one
In which two individuals
Mutually benefit from one another—
A symbiosis of souls.
ATGGTGCACCTGACTCCTGA
When love is more than just skin deep...Can you survive the graft?
Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.
Artwork Sourced from Pinterest. Artist: Unknown.
24. A Soul’s Price Tag
by Antonio Rocco S. (Rocco Valentini)
All of your vices cannot be kept at bay You have seven sins but only six bullets in your gun. You must decide which of your demons you will slay For if you do not, you’ll spend your life on the run. Vice is abundant while virtue remains elusive Thus, chaos must be reined in by order’s hand. This is why Heaven’s pearly gates are so exclusive While Hell’s open borders welcome every man. Would you rather be a lone god in a wooden church Or one among many gods in a Parthenon of marble? Are material or spiritual goods the heart of your search— Do you seek that which is sacred or that which is carnal? If you choose to stand alone Your prayers won’t be heard. You’ll keep your pride but lose your throne— A heart of gold has a wallet of myrrh. Will your robes be made of silk Or worn and tattered with holes? There’s a cost to defying your ilk— How much will you pay to keep your soul?
Artwork Sourced from Pinterest. Artist: Charles Ernest Butler.
25. A Tale of Two Kings
by Antonio Rocco S. (Rocco Valentini)
Revered by the public for his reputation and accolades; He is a king whose crown is made of fools’ gold. Monitoring the Overton Window to maintain his charade; He is a performance artist whose act has been sold. He doesn’t care about merit; he is shapeless and without color; With no substance of his own, his ambition couldn’t be clearer. He cares about being great in the eyes of others; For in the eyes of others, he sees himself in a funhouse mirror. Reviled by the public for his reputation and accolades, He is a king whose crown is made of thorns. Unwilling to adjust his views or put on a charade; His resolve remains unshaken and he endures their scorn. He holds that the universe is knowable and not strange; That there is no rolling of the dice or hidden plan. He has the courage to acknowledge what he cannot change And the strength to change what he can. Triumph emerges from banishing shadows of uncertainty, Great men approach their quest like knights upon a wagon. Their greatness is forged on the anvil of adversity; For there can be no hero without a trial, no Arthur without a dragon.