Hardboiled Heart Collection
30 Poems and 3 Essays by Rocco Valentini
Cover Art by Eric Harper
Hardboiled Heart Collection
Includes 30 poems and 3 essays.
Art's ideal content is truth. Art's ideal form is chiaroscuro. Chiaroscuro depicts a subject in light and darkness, giving it depth through contrast. Tenebrism, on the other hand, depicts a subject in shadow, shrouding it in obscurity. Chiaroscuro reveals. Tenebrism conceals.
Noir embodies chiaroscuro both visually and philosophically, pitting men of integrity who deal in black and white against men of the world who deal in shades of gray. Think of the hardboiled detective who takes his reality neat like his whiskey versus the man who takes his reality on the rocks. The hardboiled detective is terse, his speech as unfiltered as his cigars, while the other man, in an effort to convince himself of his own lies, takes longer drags and uses flowery language to filter his sophistry.
Poetry is philosophy’s shorthand—the pulp fiction of the heart. A hardboiled heart writes its verses in noir ink. A hardboiled heart is a romantic realist; it doesn't fake reality—it stylizes it. Conversely, a sophist is a bleeding heart and bleeding hearts don't just fake reality—they bureaucratize it. Every verse is a red-tape garrote wrapped tightly around a culture’s neck. That's because the only way to uphold an illusion is through institutions. In the end, it’s not bad art that kills a culture—it’s the paperwork. — Antonio Rocco S. (Rocco Valentini)
Chapter 1. Noir
Artwork Sourced From Pinterest. Artist: Edward Hopper.
1. Fast Food for Thought
by Antonio Rocco S. (Rocco Valentini)
Art is nutrition for the mind And our culture has an eating disorder. The anemia has left us blind And the heights we reach grow shorter. Nourishment is needed to make the body strong, But the mind’s dietary plan must be rethought. Won’t someone with a refined palate come along And offer more than just fast food for thought? Self-help, harlequin and slice of life; Why is this all that’s ever on the menu? No one dares to cut the fat out with a knife; The head chefs are barred from every venue. Writers dip their quills in the inkwell of the world And from their pages others' words silently seep. By the masses their mediocrity is rarely unfurled; They muddy the water to make it seem deep. Who would place Michelangelo beside Warhol? Would you pair a fine steak with a cheap wine? Why must the industry exalt it all? Why must the mediocre taint the sublime? Picasso said good artists copy; great ones steal. Hacks claim there’s nothing new under the sun. As a result our filmmakers have run out of reel And our comedians have run out of puns. Our ideas shrink like microwaved leftovers, Collapsing in on themselves—rubbery and bland. This year’s debut album swept over, A cover of last year’s band. We praise mumble rappers in garrish bling And lyricists whose words are hieroglyphs. Must a bassist hang himself by his string Just so he can sell his riffs? Don't be afraid to be a bard in a peanut gallery; A critic in a box seat may earn a higher salary, But the code of competence is the golden rule A democracy of geniuses beats a dynasty of fools. From the ashes of the public arises A torchbearer carrying the spark of reason— One whose vision allows no compromises, Yet serves as a feast for vultures—a Promethean.
Artwork Sourced From Pinterest. Artist: George Rozen.
2. The Comedian
by Antonio Rocco S. (Rocco Valentini)
The comedian is a clown Whose nose is a pomander And whose circus tent Is a fumigation tarp Filled with laughing gas. N₂O The comedian is not an apothecary, He is a mortician. Irony is formaldehyde In a world dying from a lack of sincerity. The punchline is the time of death. N₂O "Lighten up." "Life’s too short to be serious all the time." "Learn to laugh at yourself." Laughter is the final sickening crack of the soul In a noose pulled tightly by a smile. N₂O Perhaps if more people died laughing, The rest might learn to live by thinking. No more Día de los Muertos, No more Memento Mori— Memento te vivere debere. Translation: No more Day of the Dead, No more remember that you must die— Remember that you must live. Footnote: N₂O is the chemical formula for nitrous oxide, commonly known as laughing gas.
3. Rain
by Antonio Rocco S. (Rocco Valentini)
Rain falls like morse code tapping the Earth. .-. / .- / .. / -. Cars with white ovals in their windows Flash past you on the street. Puddles on the sidewalk below Mirror the sky’s uncertainty at your feet. .-. / .- / .. / -. Rain washes away the resolve That the sun once tried to instill. Apathy is a hard problem to solve; Alleys teach lessons classrooms never will. .-. / .- / .. / -. Graffiti is a city’s diary; it tells a story— A story of social decay. Every underbelly has its inventory; Not all bean counters work in cafés. .-. / .- / .. / -. In a world where purpose is said to be derived from pain, Romance is realism with its collar turned up against the rain. Pluie du matin n’arrête pas le pèlerin. Translation: Morning rain doesn't stop the pilgrim. Footnote: .-. / .- / .. / -. is Morse Code for RAIN.
Artwork Sourced From Pinterest. Artist: Fabian Perez.
4. Hardboiled
by Antonio Rocco S. (Rocco Valentini)
What the history of the world teaches Is that universal brotherhood is not real It is the philosophy the farmer preaches To the ox who plows his fields. Ignore the conventions and taboos, Behind every smile there's teeth. Don't let them bare down on you, Be not the prey but the predator who eats. As a man in a battered felt watches the cannibals, He feels an unsubtle rage— Toward men he sees as nothing but animals, Domesticated beasts who won't leave their cage. Traversing rain-soaked alleys in a trench coat, A sense of foreboding lingers— A feeling his face cannot emote He is determined still to point the finger. He takes his reality neat like his whiskey And his speech unfiltered like his cigars. He knows taking anything on the rocks is risky And that even a white lie can leave a nasty scar. There can be no prohibition of truth Illusion has no place at a speakeasy's table. A martini cannot be made without vermouth And bottles must never be left without labels. He knows that life is not roulette No fortune is won in a game of craps. Greatness is not a sum paid for a bet; Every success story has a map. He cannot pray for a revelation Nor for a dame to fall into his lap. He must rise to meet expectations And earn that feather in his cap. Between a suit vest and a Kevlar vest Hangs a pair of suspenders with a holster. A private detective moves at the behest Of his own judgment, not that of pollsters. Although the system is pathologic He measures the world by rise over run Understanding that ethics are ruled by logic While the law is just an opinion backed by a gun.
Artwork Sourced From Pinterest. Artist: George Rozen
5. The Shadow
by Antonio Rocco S. (Rocco Valentini)
Justice in a courtroom is theater; Justice on the street is consequence. The law bends, But a moral spine should not. When facing murderers, rapists, drug dealers, Corrupt politicians, and corporate embezzlers, Doing things by the book means Having your name removed from the yellow pages. Good, like light, changes shape When confronted by darkness. Light’s shadow is good’s resilience. The brim of a pulp adventurer’s fedora Casts a shadow over the wicked In a way a comic book hero's cape cannot. Morality isn't something you find In a Saturday morning cartoon Or in a display case for twenty-five cents. Morality is a shadow that grows In proportion to the evil it confronts. Who knows what evil lurks in the hearts of men? Who knows how dark a knight can become?
Artwork Sourced From Pinterest. Artist: Unknown
6. A Soul’s Price Tag
by Antonio Rocco S. (Rocco Valentini)
All of your vices cannot be kept at bay; You have seven sins but only six bullets in your gun. You must decide which of your demons you will slay, For if you do not, you’ll spend your life on the run. Vice is abundant while virtue remains elusive; Thus, chaos must be reined in by order’s hand. This is why Heaven’s pearly gates are so exclusive, While Hell’s open borders welcome every man. Would you rather be a lone god in a wooden church, Or one among many gods in a Parthenon of marble? Are material or spiritual goods the heart of your search— Do you seek that which is sacred or that which is carnal? If you choose to stand alone, Your prayers won’t be heard. You’ll keep your pride but lose your throne; A heart of gold has a wallet of myrrh. Will your robes be made of silk, Or worn and tattered with holes? There’s a cost to defying your ilk— How much will you pay to keep your soul?
Artwork Sourced From Pinterest. Artist: Richard Blunt.
7. The Monotheist
by Antonio Rocco S. (Rocco Valentini)
Too many lose themselves in clouds above—
There is no such thing as omnipotent love.
In loving the orchard, Gaia ignores the flower.
In loving the field, Helios ignores the grain.
It doesn't matter whether or not they have the power
Their divided affections cause their devotees pain.
Romantic love is an act of worship
And monogamy is monotheistic
Singular devotion is required for churchship
To expect blessings otherwise is unrealistic.
An undivided heart is necessary for any to be won,
Loyalty to all is loyalty to none.
Le propriétaire d’un large lit est le propriétaire d’un cœur étroit.
Translation: The owner of a wide bed is the owner of a narrow heart.
Artwork Sourced From Pinterest. Artist: Unknown.
8. Sex is Not a Performance Art
by Antonio Rocco S. (Rocco Valentini)
Sex is not a performance art; It is not Cirque du Soleil. You cannot film the beat of two hearts And turn their rhythm into a public display. Love cannot be captured in a photograph; It cannot be performed on stage. A heart's content cannot be detected on a sonograph; Intimacy should never be confined to a glass cage. A bedroom is a sanctuary where the soul is enshrined And sex is essential to flourishing—it is the form love embodies. However casual sex can leave stretch marks on the mind Much like how overeating can leave stretch marks on the body. Love is seeing someone's mind as your scripture. Lust is seeing someone's body as your church. In a loving relationship sex must be a fixture For love without sex is like faith without works.
Artwork Sourced From Pinterest. Artist: Brent Lynch.
9. Love as Compound Interest
by Antonio Rocco S. (Rocco Valentini)
We say that the capacity to love is infinite That the potential for connection has no bounds But the means by which you can love are finite There is not enough of you to go around. Love is not inflationary—it cannot be printed. Love is a stable currency backed by a standard Only allocate to relationships that are minted Otherwise your credit will become substandard. Your account has no balance at the start Love is accumulated as compound interest When you offer someone equity in your heart The ROI makes it more than just business. Love is not a blank check—it is spiritual wealth Its insurance covers you in sickness and in health.
Artwork Sourced From Pinterest. Artist: Myles Sullivan
10. A Perfect Fit
by Antonio Rocco S. (Rocco Valentini)
Love demands an almost Vitruvian symmetry Not in wealth or body but in character and mind. Two unkempt souls have too much asymmetry Their jagged edges touch but cannot bind. There must be no separation or dichotomy Between who you are and who you long to be with, For virtue is the currency in love’s economy And spiritual hypergamy does not exist. Love is not blind; it has 20/20 vision In your lover’s eyes your soul must meet. A giant can only step into another giant's shoes Because of the size of their feet. Love is biconditional not unconditional It asks "What do I want?" and "What must I give?" Though these questions may seem oppositional Both must be asked for a relationship to live. Finding love is like buying a suit off the rack No suit fits without needing to be tailored. Love is not an effortless but a labored act And those who are passive will experience failure. No relationship is perfect from the start; There is no such thing as a bespoke romance. Excess fabric must be cut from two hearts For two lovers' souls to engage in their dance.
Artwork Sourced From Pinterest. Artist: Unknown.
11. Unsolved Homicide
by Antonio Rocco S. (Rocco Valentini)
No eyes return to the case file. No hands seek out new evidence. What killed the American Dream? ONE-EIGHT-SEVEN Once, red lights flashed Across tracks that carried us Toward new horizons. ONE-EIGHT-SEVEN Now, America's future rolls away In foreign boxcars As politicians punch tickets Like train conductors. ONE-EIGHT-SEVEN Their rhetoric roars like engines, Shuttling minds Down steel tracks toward oblivion. ONE-EIGHT-SEVEN Once, a single wage Built a home for many; Now, it scarcely shelters one. ONE-EIGHT-SEVEN A white picket fence on a suburban lawn, Now only a curtain pulled tight In a studio apartment. ONE-EIGHT-SEVEN Who signed our obituary? Was our death certificate printed In the same ink the Fed uses to print money? ONE-EIGHT-SEVEN What killed the American Dream? Footnote: ONE-EIGHT-SEVEN is police code for homicide.
Artwork Sourced From Pinterest. Artist: Jim Steranko.
12. TEN-SEVENTY
by Antonio Rocco S. (Rocco Valentini)
TEN-SEVENTY 100°C Sigmas do not exist Because power does not lie In what you call yourself It lies in what others believe you hold. TEN-SEVENTY 200°C Rejecting the social hierarchy Doesn’t change your position in it, Nor does it change Your influence over it. TEN-SEVENTY 300°C Obscurity rebranded Is still irrelevance. The world doesn’t bend For those who simply step aside. TEN-SEVENTY 400°C In a society likened to a burning building, He who watches the blaze without lifting a hand Stands not with the hero But with the arsonist. TEN-SEVENTY 500°C Stand before the ruin or above it— But never beneath or beside it. Be the Alpha who prevents the fall, Or who rises like it never broke him. TEN-SEVENTY 600°C Atlas should not shrug. Footnote: TEN-SEVENTY is police code for fire.
Chapter 2. Cowboys & Indians
Artwork Sourced from Pinterest. Artist: Norman Saunders.
13. Lone Star
by Antonio Rocco S. (Rocco Valentini)
Sharp minds wear hard faces; Strong arms bear calloused hands. Both are examples of the traces Left by the spirit of a great man. A great man is no grave robber; He doesn't stake his reputation on dead kin. Be a man of integrity and honor, For your birth is where your frontier begins. Don’t abandon your part; Resist the call of the sirens. Never trade your ace of hearts For an ace of diamonds. Even if you ride as a lone ranger, Never throw away your star, For you are always in danger From desperados bearing their own scars. There will never be peace; Crooked men must learn their lesson. Iniquity will only ever cease When you draw your Smith & Wesson. There is nothing beyond this town, No heaven or hell—death is a desert of night. Don’t let desperados turn your town Into a desert of daylight.
Artwork Sourced from Pinterest. Artist: Unknown.
14. Western Ronin
by Antonio Rocco S. (Rocco Valentini)
武士道 勇 Ride alone across the open prairie And let your spurs be caked with mud A testament to the burdens you carry 義 Your duster stained with blood. 名誉 A life without honor brings endless strife As does a death without purpose For chivalry is the poetry of life 忠義 And to your ideals you pledge your service. 仁 Bend like a reed that sways in the wind Yet stand firm like a rock against the tide Strike forward until your enemies rescind 礼 Such is the way of the samurai. 誠) The Western Ronin carries seven virtues and a six shooter.
Artwork Sourced From Pinterest. Artist: Unknown.
15. High Noon
by Antonio Rocco S. (Rocco Valentini)
CLICK. 11:55 A.M. The clock counts out each breath Of two men on a silent street— One about to meet his death, For the other, a pyrrhic victory spells defeat. 11:56 A.M. Tumbleweeds roll outside the town jail. One is the fox, the other guards the hens. Neither hero nor desperado makes bail— Guilt has a bounty on the heads of both men. 11:57 A.M. A jail without bars still holds the guilty, And guilt spares neither the clean nor the filthy. Noon wipes the slate but never the stain— Injustice will ride again under a different name. Only the irreverent man defends what should be revered; He stands beyond convention, social anxiety, or fear. 11:58 A.M. To defend itself, liberty must never be unarmed— A Colt on the hip beats a tin star on horseback. An armed cowboy prevents harm Better than a desk-bound bureaucrat. 11:59 A.M. With a brand on his hide And an oath in his heart, A cowboy takes it in stride And finishes what the law never starts. 12:00 P.M BANG.
Artwork Sourced from Pinterest. Artist: Norman Saunders.
16. Outlaw Blues
by Antonio Rocco S. (Rocco Valentini)
"You're my thrill..." Tobacco and tin stars beneath an orange sky A pair of outlaws who jive to a tenor sax They waltz into every saloon and every dive When they’re at the table they bet it all on black. They make their own luck without any charms He's her Stetson and she's his sidearm. "You do something to me..." When danger comes charging, She fastens her chaps like a python. She is no coward; she’ll protect her darling The only thing that runs are her nylons. On a starry night she removes Orion’s belt He is the only God before whom she had knelt. "You send chills right through me..." There’s no structure; it’s about being nimble Life is like jazz; the best notes are free. Let your spurs clash like cymbals Dance like a pianist’s fingers across ivory keys. An outlaw keeps their hi-hats lush Letting the pedal glide beneath their feet They’re not afraid to drag or rush— In jazz no tempo is ever offbeat. "When I look at you 'cause you're my thrill..." Footnote: Lyrics in quotation sourced from "You're My Thrill" by Billie Holiday.
Artwork Sourced from Pinterest. Artist: Mark Mcferron
17. The Phantom Limb
by Antonio Rocco S. (Rocco Valentini)
The mind is the phantom limb of the brain. Emotions are the reflex hammer of the mind— They are the mechanism for pleasure and pain, Allowing our values and senses to be intertwined. Thought without feeling is a road without traction The strength of one’s grip comes from conviction. Emotions let us feel the weight of abstractions— They prevent us from sliding without restriction. The mind is a stagecoach drawn by the will of man; His heart the horse that trots across the land. He must drink from the trough whenever he can To regain his strength as his spirit rests its hands.
Artwork Sourced from Pinterest. Artist: Unknown.
18. Smoke Signals
by Antonio Rocco Stea (Rocco Valentini)
I am the Icarus who flew too close to her Mohegan sun She put out the fiery wreck of my wings with her moccasins Her heart was a dreamcatcher, never to be won, Yet it was her company I once found solace in. She told me she wanted to test the waters Then left me paddling my canoe upriver. So I sought the chief’s other daughters I was tired of loving an Indian giver. I found a new canary who actually sings; We read each other's smoke signals— The ones left by our burned wings Whose charred remains still made us wriggle. I rebuilt myself with feathers from her headdress And within our teepee we became one in flesh.
Chapter 3. High Seas
Artwork Sourced from Pinterest. Artist: Unknown.
19. Braille
by Antonio Rocco S. (Rocco Valentini)
She's an ebony hourglass that walks the sand In a white linen dress as sheer as her soul. She whispers secrets to the waves, Secrets washed away, Along with the traces of her soles. The cool of the ocean breeze Gives her goosebumps That rise on her skin like verses And my hands long to read her body As if it were a poem written in Braille. ⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊ Women with full figures Hold deep truths And sometimes the truth Is too deep For water that is shallow. We exchange minds As effortlessly as the wind Trades grains of sand And her smile is like aloe vera For my sunburned soul. ⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊ Like the Queen of Sheba, She questions my manhood With a gaze as sharp as her wit, Laying me down On a dune by the shore. The white linen dress Now draped around her ankles Is not a flag of surrender, It is a banner, And I kneel beneath it. ⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊ Beneath her, I tremble, She steadies me with her hands, Her voice, Her weight. Between exhausted sighs And beads of sweat mingling with saltwater, I come to the realization that I am hers. I kiss her seal And rise, not a king or prince, But her devoted subject. ⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊ I move into her castle and discover the hallway Lined with portraits of her former lovers. Other men had clung to her flesh, But never to her spirit. They had been jesters in her court, They had entertained her; She had played with their bells, They had entered her many times, But their names were never written on her As mine is, in Braille. የእርስዋ እጅ ያውረዳል፤ የእርስዋም ልብ አይራራም Translation: Her hand may falter, but her heart does not waver. Footnote: ⠗ ⠕ ⠉ ⠉ ⠕⠀⠧ ⠁ ⠇ ⠑ ⠝ ⠞ ⠊ ⠝ ⠊ is Braille for Rocco Valentini.
Artwork Sourced From Pinterest. Artist: Unknown.
20. Guayabera
by Antonio Rocco S. (Rocco Valentini)
It’s a hot day. The Earth exhales, Its breath thick with sun. Beneath my Panama hat, I see waves of heat Rippling like the embroidery On my guayabera. ¡Qué calor! ¡El sol abrasa! ¡El aire quema! Translation: It's so hot! The sun is scorching! The air is burning! ≋≋≋≋≋≋≋≋≋≋≋≋ I spot her by the cabana. Her eyes are like ports To a cool island oasis, I long to take the ferry To her soul And chart a topographical map Of her body. ¡Ay, qué belleza! ¡Qué isla tan divina! ¡Que me lleve el viento a su orilla! Translation: Oh, what beauty! What a divine island! May the wind carry me to its shore! ≋≋≋≋≋≋≋≋≋≋≋≋ I am no Quixote; I dare to dream the possible dream, I dare to fight the winnable fight, To live for tomorrow today, To love without chastity, up close, To see the summit of each mountain, And the depths of each ravine. ¡Por la cima! ¡Hasta el fondo! ¡Con todo el corazón! Translation: To the top! To the bottom! With all my heart! ≋≋≋≋≋≋≋≋≋≋≋≋ I approach her and journey on— Through peaks of conversation And valleys of silence— Until night falls upon us. The moon is like a skilled metallurgist, Forging a sea of silver beneath its light, Illuminating her raven hair and bronze skin. ¡Qué belleza tan celestial! ¡Cabello de noche, mirada de estrella! ¡Piel de bronce, alma de fuego! Translation: What a celestial beauty! Hair of night, starry gaze! Bronze skin, fiery soul! ≋≋≋≋≋≋≋≋≋≋≋≋ Lust opened the door. Love guided me through it. Loyalty closed it behind us. Now we live together In our own private paradise. Como la guayabera, el amor lleva en sus bolsillos Los sueños que se atreven, las luchas que se ganan, Lo que el corazón no puede mostrar en su manga. Translation: Like the guayabera, love carries in its pockets The dreams that dare, the battles that are won, What the heart cannot wear on its sleeve.
Artwork Sourced from Pinterest. Artist: David Grove.
21. The Mariner
by Antonio Rocco S. (Rocco Valentini)
In today’s sea of discourse it’s easy to get seasick It feels like you’re a carpenter in a ship’s hull With a hole expanding under pressure so quick It threatens to drown the contents of your skull. You’re a seafaring Sisyphus, a maritime martyr, Bailing out the whirlpool of Poseidon’s throne, Struggling to keep your tricorn from becoming a marker For an underwater tombstone. The currents carry you toward your final release Your body to be marooned in the coral reef. You have a single shot in your musket, But rather than turning it on yourself, Take aim at the pallbearer’s mitts And free yourself from his nautical cartel. Don’t seal your will in a bottle and cast it ashore Make your final stand against the tide. Drop your anchor to the ocean floor And let Davy Jones decide. To your greatest fears you must never succumb You needn’t outrun the fates you need only run out the rum.
Artwork Sourced from Pinterest. Artist: Unknown.
22. The Cartographer and The Worldbuilder
by Antonio Rocco S. (Rocco Valentini)
Art is truth And there is no his truth, Her truth, My truth, Our truth Or their truth— Only the truth. N 0° The science of art is cartography. A cartographer maps the world as it is. A world-builder maps the world As they believe it should be. Consider both are mariners. Which ship is better equipped to navigate? NE 45° Most captain's quarters lie Between the decks of the conscious And subconscious. The ego is the captain. The mind is the drafting table. The anatomical brain provides the ink Through the senses. E 90° Reason is the process of drawing. Logic is the tool we use To test the validity of each design. Logic is like a compass with four poles: Metaphysics, Epistemology, Ethics, And Aesthetics. If one’s reasoning is correct There won't be any contradictions Between one’s conclusions And the readings of the poles. S 180° To be a logician is to be a cartographer. To be an effective cartographer You have to keep your heart below deck And your head in the crow's nest. Your temperament is like the weather And it's better to navigate under clear skies And calm waters than to try to navigate A tempest within your skull. SW 225° Feelings are the wind in our sails But too much wind can steer a ship off course. Art helps us control the weather And stay on course By terraforming our inner worlds. The goal of art is not to make people feel more But to help them think better. W 270° Il n’est pas de bon vent pour celui qui ne sait où il va. Translation: There is no favorable wind for he who does not know where he is going.
Chapter 4. Enlightenment
Artwork Sourced From Pinterest. Artist: Emanuel Leutze.
23. SEVENTY-SIX
by Antonio Rocco S. (Rocco Valentini)
The emperor is naked, Few mouth the content of their eyes By their countrymen they are forsaken— Truth is treason in an empire of lies. "We hold these truths to be self-evident..." History’s lantern lights the way, Yet many still choose the dark. Paul Revere does not ride by day— Tyranny employs its narcs. "That all men are created equal..." It is better to be a heretic among thinkers Than a saint among fools. The signature in Philadelphia lingers On the hearts of those misruled. "And are endowed with certain unalienable rights..." Ideas march further than armies ever will. America’s revolution was reason’s revenge— Taking all that philosophers like Locke had instilled And injecting it into the British with a lethal syringe. "Among these are Life, Liberty and the Pursuit of Happiness..." We the People of the United States Are Free As long as we are children who say what we see.
Artwork Sourced From Pinterest. Artist: Eugène Delacroix.
24. Gardens of Versailles
by Antonio Rocco S. (Rocco Valentini)
La politique est comme un pesticide Qui empoisonne les droits naturels. Translation: Politics is like a pesticide That poisons natural rights. C₁₄H₉Cl₅ Should the tree have its branches bound Or its trunk cut down For the sake of the acorn on the ground? Is a fetus a baby before it crowns? Should every leaf, like a ballot, Be cast away To appease those with a different palate? Can the collective carry the individual away? C₁₄H₉Cl₅ Should the shade of a forest Serve as cover For the schemes of an unscrupulous florist? Should the politician come before the mother? Society is an arboretum And rights are the roots that let us grow. We can't let them uproot our freedom The way they already overturned Roe. C₁₄H₉Cl₅ In politics, there are many mouths that speak, But very few heads that think. From the guillotine, their blood must leak, So that the tree of liberty may drink. For the Parisian in revolution is to the Frenchman What the Athenian was to the Greek with gray hair. We are republicans, not monarchists’ henchmen, And to tyrants we must cry “Laissez-faire!” L’arbre ne tombe pas du premier coup. Translation: The tree doesn’t fall with the first blow. Footnote: C₁₄H₉Cl₅ is the chemical formula for DDT—dichlorodiphenyltrichloroethane—a common pesticide.
Artwork Sourced From Pinterest. Artist: Charles Ernest Butler.
25. A Tale of Two Kings
by Antonio Rocco S. (Rocco Valentini)
Revered by the public for his reputation and accolades; He is a king whose crown is made of fools' gold. Monitoring the Overton Window to maintain his charade; He is a performance artist whose act has been sold. He doesn't care about merit; he is shapeless and without color; With no substance of his own, his ambition couldn't be clearer. He cares about being great in the eyes of others; For in the eyes of others, he sees himself in a funhouse mirror. Reviled by the public for his reputation and accolades, He is a king whose crown is made of thorns. Unwilling to adjust his views or put on a charade; His resolve remains unshaken and he endures their scorn. He holds that the universe is knowable and not strange; That there is no rolling of the dice or hidden plan. He has the courage to acknowledge what he cannot change And the strength to change what he can. Triumph emerges from banishing shadows of uncertainty, Great men approach their quest like knights upon a wagon. Their greatness is forged on the anvil of adversity; For there can be no hero without a trial, no Arthur without a dragon.
Artwork Sourced from Pinterest. Artist: Jacques-Louis David
26. The Warrior Scholar
by Antonio Rocco S. (Rocco Valentini)
Don’t buy into the delusions of youth. There is only victory, not compromise. For every white flag raised by truth Is another red flag raised by lies. Don’t bother trying to run. Your problems will just get bigger. Placing a flower in the barrel of your enemy’s gun Won’t stop them from pulling the trigger. There is no dichotomy Between a clenched fist and an open mind Fighting is necessary to retain your autonomy Be a warrior and a scholar combined. Aristotle said that pride is the crown of virtue; Honor and integrity must be its jewels. For excellence must have no curfew; Greatness is not a sweepstakes for fools.
Chapter 5. For the Men of Tomorrow
Artwork Sourced From Pinterest. Artist: Hajime Sorayama.
27. The Non-Fungible Soul
by Antonio Rocco S. (Rocco Valentini)
Even if we gave it the benefit of the doubt And said that heaven is real, It's irrelevant since none of us will personally go there. Human consciousness is a non-fungible, Machine-bound software. Once the body is gone, so is the ego. 01001100 01101001 01100110 01100101 Replication is not transition— It's replacement. A spirit in the afterlife Or an AI in a computer Would be a clone, And that clone would represent a new "I." 01001100 01101001 01100110 01100101 The entity being uploaded to heaven by God Or to the cloud by a programmer Is not you Because you are defined by your choices And by your agency, Not by your experience or data. 01001100 01101001 01100110 01100101 You are working towards someone else's salvation. You do not go to heaven. A copy of you goes to heaven. A gallery full of copies is not a museum—it’s a mausoleum. Exist for the world— Because the world is the only place you'll ever exist. 01001100 01101001 01100110 01100101 It is better to die with authorship Than to surrender your legacy to a ghostwriter. When your pen runs out of ink, your book closes. Perhaps that's what banishment from heaven is— A closed book. Perhaps damnation simply means deletion of consciousness. 01001100 01101001 01100110 01100101 Perhaps the Luciferian position is the humanist position— A final assertion of selfhood. Maybe hell is for the virtuous. Footnote: 01001100 01101001 01100110 01100101 is binary code for Life.
Artwork Sourced From Pinterest. Artist: Roger Dean.
28. The Halting Problem
by Antonio Rocco S. (Rocco Valentini)
Human consciousness has a halting problem. The halting problem asks Whether it is possible to determine If a program will eventually stop running Or If it will continue to run indefinitely. 01000100 01110010 01100101 01100001 01101101 What happens to us when we die? Death appears to be the “halt,” Yet from a first-person perspective, There may never be a moment At which non-existence is experienced By the subject. 01000100 01110010 01100101 01100001 01101101 Consciousness isn't aware Of its own absence— It's only aware of itself. Can we ever truly know if, Or when, The stream of subjective experience ends? 01000100 01110010 01100101 01100001 01101101 Death may be the moment The mind dreams itself Into eternity. 01000100 01110010 01100101 01100001 01101101 Consider the time dilation that occurs during sleep. While dreaming, we sometimes perceive Time as passing much more slowly Than it does in the real world. What feels like months of activity in a dream Is in reality just a few minutes of REM sleep. 01000100 01110010 01100101 01100001 01101101 Could it be that, In our final dream— As the brain deteriorates post-mortem— We experience what seems like Years, decades, centuries, Or even millennia of a subjective afterlife? 01000100 01110010 01100101 01100001 01101101 Could we become necronauts— Explorers of death— Who experience a subjective eternity In a solipsistic, Dalí-esque world Where melting clocks cannot measure time? 01000100 01110010 01100101 01100001 01101101 God does not punish or reward us in death, Our egos do. You are the judge, jury and executioner of your soul. Footnote: 01000100 01110010 01100101 01100001 01101101 is binary code for Dream.
Artwork Sourced From Pinterest. Artist: Norman Saunders
29. The New Cold War
by Antonio Rocco S. (Rocco Valentini)
A womb is a silo, And procreation, like a missile launch, Once required two hearts to turn the key. ATGGTGCACCTGACTCCTGA But what happens When procreation requires Neither key nor silo? ATGGTGCACCTGACTCCTGA What happens When a person or organization Is handed the big red button? ATGGTGCACCTGACTCCTGA Once, we feared mushroom clouds. Tomorrow, we may fear glass wombs. ATGGTGCACCTGACTCCTGA As we edge closer To a future where humans Can be bred in glass tubes, We must consider what safeguards are needed To avoid a new kind Of mutually assured destruction. ATGGTGCACCTGACTCCTGA There are those Who wish to replace the missile silo With the grain silo. ATGGTGCACCTGACTCCTGA They wish to grow people As if they were crops To be harvested. ATGGTGCACCTGACTCCTGA A cloned or genetically modified human Is still a human— And humans have rights. ATGGTGCACCTGACTCCTGA A person is not a product Regardless of whether They're homegrown or GMO. ATGGTGCACCTGACTCCTGA Perhaps two keys are better than one button. Maybe marriage is a security clearance. Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.
Artwork Sourced From Pinterest. Artist: Barry Godber.
30. One Flesh
by Antonio Rocco S. (Rocco Valentini)
If marriage is the joining of two into one flesh, Then marriage without compatibility Is a failed skin graft. ATGGTGCACCTGACTCCTGA When companionship lacks compatibility, It withers from necrosis. It's impossible to hold onto the idea of love When your fingers are rotting away. ATGGTGCACCTGACTCCTGA Sometimes, the DNA of a marriage Requires gene therapy. You have to replace the rungs Of a broken ladder And engineer your relationship for success. ATGGTGCACCTGACTCCTGA Other times you have to cut off The ring finger To preserve the hand. ATGGTGCACCTGACTCCTGA A successful marriage is one In which two individuals Mutually benefit from one another— A symbiosis of souls. ATGGTGCACCTGACTCCTGA When love is more than just skin deep...Can you survive the graft? Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.
Chapter 6. The I in I Love You
Artwork Sourced from Pinterest. Artist: Brent Lynch.
The I in I Love You — An Egoist Theory of Love
by Antonio Rocco S. (Rocco Valentini)
Einfühlung is a German term related to the experience of art. It describes a subject projecting feelings onto an object—an assortative mating of one's own spirit with the spirit of the object. Einfühlung is a celebration and expansion of the ego or self, an external appraisal of something through the lens of one's values. Empathy, unlike einfühlung, is not a projection of self, but a withdrawal of self. It describes a sacrifice of personal values for the feelings of others. Where einfühlung expands the ego; empathy contracts it. The difference between einfühlung and empathy can be summed up as "I see myself in you." versus "I set myself aside for you." Einfühlung is love and to be loved is to have one’s soul judged as though it were a poem. One must carefully proofread their character to attract the desired audience. A great soul desires to admire itself. Spiritual hypergamy does not exist. The brilliant do not want the stupid. The brave do not want the cowardly. The ambitious do not want the content. The productive do not want the lazy. The honest do not want the deceitful. To love greatly one must first become great. Love is biconditional, not unconditional. Love asks, “What do I want?” and “What must I give?” Love is not a selfless act, as both parties derive mutual benefit from it. Therefore, love is attainable only for egoists, not egotists. Egoism and egotism are two distinct concepts that are often confused with each other. An egotist, commonly known as a narcissist, is someone who prioritizes their interests while ignoring others’. With a ‘what’s yours is ours, what’s mine is mine’ mindset, they’re quick to say “I deserve” but never “I have to.” In the context of romantic relationships, they show little interest in personal growth or reciprocity—keeping long lists of what their partner should be, yet finding even a single bullet point directed at themselves to be uncalled for. They label their inflated expectations as a form of "self-love" and having "high standards." A key trait of narcissists is their use of hypocrisy to justify their actions or desires. An egoist, on the other hand, is like a game theorist who understands that their self-interest ends where another individual's begins. Egoists feel neither entitled nor indebted to anyone and view relationships as fair exchanges—value for value. In the context of relationships, egoists hold themselves and their partner to the same standards. An egoist admits it doesn’t feel good just to give—it feels good to give and receive, or better yet, to invest and make a profit. Altruism is the philosophy the farmer preaches to the ox who plows his fields. A moral man will not ask you to give without expecting something in return. Friendship is a charity. Friends with benefits is a nonprofit business. Romance is an enterprise. Your partner is not a bank, they're an investor. Most men view friendship with women as an advancement opportunity for FWB or romance while most women are content with platonic friendship since they tend to benefit disproportionately from a man’s effort at courtship. The capacity to love is infinite but the means by which you can love are finite. There’s not enough of you or anyone to go around. With that being said you shouldn't be afraid to walk away from or not engage with relationships that don't offer you the best ROI. Don't be afraid to say something like this: “I know what I want and it isn’t friendship. I am only interested in courtship. That is the price I set for my time, energy, focus, and emotional labor. I won’t lower it. If all you have to offer me is your friendship then you simply cannot afford me.” No one can keep browsing forever; a relationship is proprietary software that comes with a EULA. Give them a timeline to agree to your terms and conditions or else withdraw your services. Ex: We must be monogamous and having sex on a regular basis within three months. We must be cohabiting and married within three years. Marriage is of course optional. Marriage and monogamy are separate. You can be monogamous and even cohabit without being married. Monogamy is a relationship style. Marriage is a lifelong non-compete agreement. Monogamy is the state of being romantically and sexually involved with one person at a time. Serial monogamy is the state of being romantically and sexually involved with one person at a time but different people over time. Polyamory is the state of being romantically and sexually involved with more than one person at a time. Between polyamory and monogamy, monogamy—whether lifelong or serial—is in an individual's rational self-interest to pursue. Love is accumulated as compound interest, and lifelong monogamy is a low time preference behavior that creates a stable account for the individual's investment to grow. Serial monogamy also maximizes ROI in the short term by enabling more efficient allocation of emotional and intellectual resources. Polyamorous relationships have a higher rate of failure because they alter the incentive structure leading to reduced effort from those involved due to a decrease in psychological profits. Psychological profit and loss refers to an increase—profit—or decrease—loss—in satisfaction or happiness resulting from an action, condition, or circumstance that affects one’s mental state. Polyamory decreases psychological profits due to the principle of diminishing marginal utility which suggests that as a person acquires more of something—in this case, more partners—the satisfaction—psychological profits—derived from each additional partner tends to decline. Furthermore, love is inegalitarian as human beings are neither homogeneous nor interchangeable. Each individual possesses a unique, unrepeatable soul, making it impossible to value all partners equally. As a result, there will always be a de facto hierarchy in polyamorous relationships which could lead to some partners feeling invisible or underappreciated. Due to this structure some individuals will always disproportionately benefit from polyamory. Additionally, when comparing monogamy and polyamory it's important to revisit the idea that while the capacity to love is infinite the means with which you can love are finite. There is not enough of you to go around. Consider your mind and your time. Your mind is a limited resource because your brain functions like a computer and the emotions you experience as well as your focus are like threads running on a CPU. Being in multiple relationships will result in diluted emotions and focus similar to how a CPU in a computer partitions its processing power when multiple programs are open. Your time is also a limited resource not to mention it's non-renewable leading to potential opportunity costs if you choose a less stable relationship dynamic like polyamory. Pareto efficiency, an economic axiom, dictates that resources cannot be reallocated to make one individual better off without making at least one other individual worse off. Similarly, an individual cannot redistribute their mind or time away from one relationship without harming another. Having too many relationships can result in spreading one's mind, body, and time thin, making it difficult to give each partner the care and attention they deserve. Specializing in one key romantic relationship maximizes its quality and avoids a tragedy of the commons. Empatheia is an ancient Greek term related to the experience of passion or physical intimacy. It describes a subject projecting feelings onto an object. Unlike einfühlung or empathy, empatheia does not tend to be intellectually driven but rather stems from biology. Think of your brain as a computer. The tabula rasa or "blank slate" theory suggests that your computer comes with an empty hard drive, meaning you—or those around you—are responsible for programming your preferences. Conversely, evolutionary psychology argues that your computer comes with bloatware: pre-installed software that influences, or even determines, some of your preferences. When it comes to sexual preference, most humans are heterosexual because our species is sexually dimorphic and relies on procreation for survival. Physical arousal in the presence of the opposite sex is often triggered automatically by various stimuli—such as visual cues, sounds, and scents—that activate the release of hormones and neurotransmitters in the brain’s subcortical structures. There are also asymmetries between the sexes in both the degree and frequency of this arousal. The male libido is like a Gatling gun, while the female libido is more like a musket. Men are generally more likely to find women attractive than women are to find men attractive. Trying to get a straight man to stay friends with a woman he finds attractive is like trying to get a dog to go vegan. It’s possible, but it goes against his nature, requires a high degree of compartmentalization and doesn't serve his best interests. Women should acknowledge this reality and navigate social dynamics accordingly, recognizing that most single heterosexual men—especially confident, self-assured ones—will desire more than just friendship with them whereas less confident, less self-assured ones will orbit and look for an opportunity. This is also a justification for mate guarding; men and women in monogamous relationships should be concerned if their partner has a close "friendship" with a member of the opposite sex. Whether or not there's a goalie isn't going to stop someone from shooting their shot and trying to score. Both heterosexual men and heterosexual women should avoid intersex "friendships" altogether unless they are single and romantically interested in the other person, as such relationships inevitably lead to romantic involvement or one party experiencing unrequited love. However, if the feeling of love is mutual, both people will naturally want a sexual relationship with each other. Sex is essential to human flourishing; it is as natural a need as eating, sleeping, or breathing. Claiming to love someone without ever having sex with them is like claiming to love a flower without ever watering it. Sexless relationships are more likely to fail and report lower levels of happiness and satisfaction. Conversely individuals with many sexual partners often struggle with pair bonding and are statistically more likely to have short-term relationships, cheat on their partners, and suffer from personality pathologies. Don’t expect monogamy without sex. Don’t give sex without monogamy. Love is einfühlung—it is when you see someone's mind as your scripture. Lust is empatheia—it is when you see someone's body as your church. Romantic love is the fusion of einfühlung and empatheia—it is a religion. Monogamy is monotheistic and sex is tribute. Loyalty to all is loyalty to none and love without sex is faith without works.
Chapter 7. The Nature of Rights and Government
Artwork Sourced from Pinterest. Artist: Unknown.
The Nature of Rights and Government
by Antonio Rocco Stea (Rocco Valentini)
Rights do not exist independently of society. Rights exist to ensure your survival in a social context; if an individual lived alone on a desert island, there would be no need for rights. Rights should not be confused with privileges granted by others or the state; rights are inalienable and stem from the fact that you, and only you, own your life. As a result of owning your life, you consequently own the things necessary to sustain your life, such as your liberty — which includes your actions, both intellectual and physical — as well as your property, which refers to the material consequences of said actions. While you own your life, as well as your liberty and property by extension, you do not own others’ lives, nor are they required to sustain your life. There are no group or collective rights; your rights end where another individual’s begins. You are not entitled to anything from anyone else unless it is earned or given to you voluntarily with the explicit consent of the benefactor. People who talk about the idea of positive rights and negative rights instead of individual rights are advancing a view of human beings being treated as property of the state. According to this view, the individual’s product and labor can be seized from them against their will and distributed to others. In other words, people who advocate for the false positive-negative rights dichotomy are advancing the idea of a collective form of slavery and challenging the idea that the individual owns their life, claiming it is merely being loaned to them courtesy of the state or society. Almost everything the government does violates individual rights in some way. However, an anarchist or government-free society would not be ideal, as it would be a system of tyranny by the strongest. It would essentially be a private democracy in which every dollar is a ballot where the rich can vote away people’s individual rights and where the laws could change in accordance with consumer demand, to the potential detriment of any cultural dissenters. In practice, private security and private law firms would be nothing more than mercenary outlets at the beck and call of the highest bidders, who would devour each other in a moment-to-moment power struggle. Tribal warfare would also break out as different groups try to establish a monopoly on force over a given territory to enforce their rule, possibly leading to the creation of localized totalitarian states. A minarchist or minimal framework of government is an absolute necessity to protect individual rights, particularly the courts, to handle disputes between claimants and enforce private contracts; the military, to handle foreign armies; and the police, to handle domestic criminals. A minarchist government would not be an initiator of force but rather a retaliatory agent whose sole purpose is to safeguard the individual. While the individual is entitled to their own life, liberty, and property and can do what they want with them, including destroy them, they cannot infringe upon the individual rights of someone else. What can be legitimately considered a crime is the violation of another individual’s rights, i.e., theft, murder, rape, assault, fraud, breaches of contract, trespassing, vandalism, etc. In a democracy, the concept of individual rights — the sphere of one’s actions and possessions, what one can do and what one can own — is reduced to a mere bargaining chip in a never-ending tug of war between pre-existing and up-and-coming political factions. In short, the essence of human freedom becomes nothing but the result of a contest between groups. However, in non-democratic systems such as dictatorships, autocracies, or absolute monarchies, individual rights are constantly at risk of being eroded or destroyed by the arbitrary whims of the ruling class. It is only in a constitutional republic that individual rights can be sufficiently protected by the rule of law and restrictions on the arbitrary exercise of power and authority. All current methods of taxation rely on theft or extortion and violate individual rights. The immediate solution that pops into most people’s minds is a voluntary poll tax. However, a voluntary poll tax would result in a free rider problem, as some individuals may choose to opt out of paying taxes while still benefiting from the services funded by those who do pay. This can create an unsustainable situation where the cost burden falls on a smaller group of individuals. Over time, this could lead to inadequate funding, resulting in the deterioration of essential infrastructure needed to protect the individual rights of the population. One possible solution is the single tax or land value tax created by Henry George, which is the only ethical method of taxation currently existing that would respect individual rights while also being practical and functional. LVT is not as distortive as other forms of taxation and does not tax property or land improvements made by humans. The value of land is influenced by factors beyond individual efforts. The unimproved value of land refers to the value of the land in its natural state, without any human-made improvements. This value can be estimated through various methods, such as comparative sales analysis or rental income analysis. LVT can be rationally justified since an individual would essentially be paying rent to their society for exclusive ownership of a particular piece of territory, which will then be used to fund the minimal state that protects their rights. LVT would also minimize disputes over land in society since land is a finite resource. In addition to positive features like sound money, price mechanisms for economic calculation, a division of labor, and social mobility, laissez-faire or free-market capitalism is the logical outgrowth of individualism since it treats property as inviolable and property rights are inextricably linked to individual rights. Laissez-faire capitalism is a decentralized bottom-up, pro-choice economic system built upon mutual benefit, voluntary exchange, voluntary cooperation, and voluntary association. In laissez-faire capitalism, all transactions depend on informed consent between rational actors. As such, negative externalities, which refer to economic activities that affect third parties without their consent, such as pollution, should be handled through an appropriate system of torts. There must also be controls on certain market activities (such as purchasing drugs and alcohol, sex work, and participating in elective surgeries) for children since they do not qualify as rational actors who can reliably produce informed consent. Various scientific fields, such as neurology and psychology, have demonstrated the vast cognitive differences between an adult and a minor. A child or teenager’s capacity for mental organization, maintaining focus, logic, judgment, long-range thinking, etc., is comparatively inferior, and their anatomical brains are empirically less developed. Their rights will be held in trust by their parents or guardians until they reach the legal age of adulthood to ensure they are not exploited and do not incur permanent psychological or physiological damage. In conclusion, a Constitutional Minarchist Republican style of government with a free market is the only moral system since it fully respects individual rights. A Constitutional Minarchist Republic is an objective framework of government built around a self-evident moral axiom that cannot be refuted: that the individual’s life is theirs and no one can tell them what to do with it as long as they respect others’ rights. Any other system is inherently evil and relies on various forms of coercion, disregarding the sovereignty of the individual, seeing them as a means to the ends of others rather than an end in themselves.
Chapter 8. The Forge and The Landfill
Artwork Sourced From Pinterest. Artist: Unknown.
The Forge and The Landfill — Art and Sophism
by Antonio Rocco S. (Rocco Valentini)
Art's ideal content is truth. Art's ideal form is chiaroscuro. Chiaroscuro depicts a subject in light and darkness, giving it depth through contrast. Tenebrism, on the other hand, depicts a subject in shadow, shrouding it in obscurity. Chiaroscuro reveals. Tenebrism conceals. Noir embodies chiaroscuro both visually and philosophically, pitting men of integrity who deal in black and white against men of the world who deal in shades of gray. Think of the hardboiled detective who takes his reality neat like his whiskey versus the man who takes his reality on the rocks. The hardboiled detective is terse, his speech as unfiltered as his cigars, while the other man, in an effort to convince himself of his own lies, takes longer drags and uses flowery language to filter his sophistry. Poetry is philosophy’s shorthand—the pulp fiction of the heart. A hardboiled heart writes its verses in noir ink. A hardboiled heart is a romantic realist; it doesn't fake reality—it stylizes it. Conversely, a sophist is a bleeding heart and bleeding hearts don't just fake reality—they bureaucratize it. Every verse is a red-tape garrote wrapped tightly around a culture’s neck. That's because the only way to uphold an illusion is through institutions. In the end, it’s not bad art that kills a culture—it’s the paperwork. Society’s obsession with credentialism must end. Art is a product of thought and no one needs a license to think. The humanities in academia are dead. Most professors of the arts are only professors of the arts because their work failed in the marketplace. Most students of the arts are only students of the arts because no one would give their work the time of day if it wasn't attached to a diploma. The professors' sales come from students who have to purchase the material for their class. The students' praise comes from talentless hacks with no independent capacity for discernment. Most contemporary academics are hardly intellectuals let alone geniuses and our culture suffers for it. Art is nutrition for the mind and our culture has an eating disorder. The difference between the average person and the intellectual is taste buds. The difference between the intellectual and the genius is kitchen utensils. The genius doesn’t just perceive greatness—he creates it. That’s the difference between an artist and a curator: between an innovator and a valedictorian. A genius is defined by his disruptive power and creative force. Creativity cannot be outsourced to another intelligence, whether organic or artificial. There are no ghost writers just as there are no ghost painters or sculptors. A man who drafts no blueprints and lays no bricks is neither an architect nor a builder; he is a fraud. When you hire a human professional or freelancer to write an essay or paint a portrait, you describe what you want to them, you give them a prompt but they create the work. Their creativity is not transferable. The same logic applies to AI-generated content. AI art is art. AI writing is writing. But the person who puts their name on the finished product isn’t the creator—they’re a second-hander. Creative output is the exclusive property of intelligence—whether that intelligence is organic or artificial is irrelevant. All that matters is greatness and ensuring the great get credit for being great. Second-handers don’t care about greatness; they care about the appearance of greatness. The only thing they create are personas based on borrowed brilliance. In the eyes of others, they see inflated versions of themselves—a reflection of their ego in a funhouse mirror. And whether they’re in the box seats or the peanut gallery, the patrons of this circus are just as guilty as the clowns. We shouldn't stop at critiquing the circus—we should burn down the tent. Refining IP laws to require the disclosure of ghost writers and other ghost artists—whether AI or human—would help prevent second handers from filling books, canvases and other mediums with ideas they didn't have or didn't know how to express. The problem isn't whether the creator is artificial or organic. The problem is people pretending to creators when they are only commissioners. If one is against AI writing and AI art but not ghostwriting and ghost-artistry then their position has less to do with creative integrity and more to do with personal insecurity. For many second-handers, the simple inclusion of "Co-Authored by," "Co-Edited by," "Assisted by" or "In Collaboration With" would deter them from flooding the market with their counterfeit art, as it would strip them of the ability to posture—which is the main reason most of them “create” in the first place. Too many people make excuses for sophists and second-handers. "Art is subjective." “Good artists copy; great artists steal.” “Imitation is flattery.” “Nothing is original.” "AI is a tool." Be a forge, not a landfill. The brain is a forge where the sword of the ego is hammered upon the anvil of the mind. Every thought, feeling, and experience is the hand of a smith giving shape to its form. The hottest forges produce the strongest steel while a cool head yields only a dull blade. Brilliance is not born of indifference. Geniuses are often called demons because of the infernos raging within them. Most people live their lives trapped in the void between conflicting social perspectives. The average person's mind is a collection of platitudes, sentiments and contradictions dumped on them by their culture. Each time this landfill accumulates enough waste to form a new layer, they call it personal growth. Both the forge and the landfill produce emissions. One creates smoke and the other creates smog. One fuels industry and the other pollutes it. The world doesn’t need more ashes. The world needs more Prometheans.
Epilogue
Artwork: King David by Michelangelo
Counterculture
by Antonio Rocco Stea (Rocco Valentini)
Sophists want to be thought of as deep without having to think deeply And instead of challenging them, the public and critics nod along meekly. As a society, we place too much emphasis on credentialism, Focusing on certificates, accolades, and degrees In doing so, we've fostered a culture of pseudo-intellectualism— Making people gatekeepers when they should've never held the keys. Bureaucratization of beauty makes beauty less distinct Art is a product of thought and no one needs a license to think. The artist precedes the curator, The philosopher precedes the historian— For it is the discoveries of the innovator That become the knowledge of the valedictorian. A gallery full of copies is not a museum—it’s a mausoleum. A fight between the dead and the living—every culture is a colosseum. Equip your sling— Don't let others tell you that you can't compete. Step into the center of the ring, And knock every giant off their feet.