Artwork Sourced From Pinterest. Artist: Barry Godber.
One Flesh
by Antonio Rocco S. (Rocco Valentini)
If marriage is the joining of two into one flesh, Then marriage without compatibility Is a failed skin graft. ATGGTGCACCTGACTCCTGA When companionship lacks compatibility, It withers from necrosis. It's impossible to hold onto the idea of love When your fingers are rotting away. ATGGTGCACCTGACTCCTGA Sometimes, the DNA of a marriage Requires gene therapy. You have to replace the rungs Of a broken ladder And engineer your relationship for success. ATGGTGCACCTGACTCCTGA Other times you have to cut off The ring finger To preserve the hand. ATGGTGCACCTGACTCCTGA A successful marriage is one In which two individuals Mutually benefit from one another— A symbiosis of souls. ATGGTGCACCTGACTCCTGA When love is more than just skin deep...Can you survive the graft? Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.


