One Flesh

Poem by Rocco Valentini

Artwork Sourced From Pinterest. Artist: Barry Godber.

One Flesh

by Antonio Rocco S. (Rocco Valentini)

If marriage is the joining of two into one flesh,
Then marriage without compatibility
Is a failed skin graft.

ATGGTGCACCTGACTCCTGA

When companionship lacks compatibility,
It withers from necrosis.
It's impossible to hold onto the idea of love
When your fingers are rotting away.

ATGGTGCACCTGACTCCTGA

Sometimes, the DNA of a marriage
Requires gene therapy.
You have to replace the rungs
Of a broken ladder
And engineer your relationship for success.

ATGGTGCACCTGACTCCTGA

Other times you have to cut off
The ring finger
To preserve the hand.

ATGGTGCACCTGACTCCTGA

A successful marriage is one
In which two individuals
Mutually benefit from one another—
A symbiosis of souls. 

ATGGTGCACCTGACTCCTGA

When love is more than just skin deep...Can you survive the graft?

Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.