The New Cold War

Poem by Rocco Valentini

Artwork Sourced From Pinterest. Artist: Norman Saunders

The New Cold War

by Antonio Rocco S. (Rocco Valentini)

A womb is a silo,
And procreation, like a missile launch,
Once required two hearts to turn the key.

ATGGTGCACCTGACTCCTGA

But what happens
When procreation requires
Neither key nor silo?

ATGGTGCACCTGACTCCTGA

What happens
When a person or organization
Is handed the big red button?

ATGGTGCACCTGACTCCTGA

Once, we feared mushroom clouds.
Tomorrow, we may fear glass wombs.

ATGGTGCACCTGACTCCTGA

As we edge closer
To a future where humans
Can be bred in glass tubes,
We must consider what safeguards are needed
To avoid a new kind
Of mutually assured destruction.

ATGGTGCACCTGACTCCTGA

There are those
Who wish to replace the missile silo
With the grain silo.

ATGGTGCACCTGACTCCTGA

They wish to grow people
As if they were crops
To be harvested.

ATGGTGCACCTGACTCCTGA

A cloned or genetically modified human
Is still a human—
And humans have rights.

ATGGTGCACCTGACTCCTGA

A person is not a product
Regardless of whether
They're homegrown or GMO.

ATGGTGCACCTGACTCCTGA

Perhaps two keys are better than one button.
Maybe marriage is a security clearance. 

Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.