Artwork Sourced From Pinterest. Artist: Norman Saunders
The New Cold War
by Antonio Rocco S. (Rocco Valentini)
A womb is a silo, And procreation, like a missile launch, Once required two hearts to turn the key. ATGGTGCACCTGACTCCTGA But what happens When procreation requires Neither key nor silo? ATGGTGCACCTGACTCCTGA What happens When a person or organization Is handed the big red button? ATGGTGCACCTGACTCCTGA Once, we feared mushroom clouds. Tomorrow, we may fear glass wombs. ATGGTGCACCTGACTCCTGA As we edge closer To a future where humans Can be bred in glass tubes, We must consider what safeguards are needed To avoid a new kind Of mutually assured destruction. ATGGTGCACCTGACTCCTGA There are those Who wish to replace the missile silo With the grain silo. ATGGTGCACCTGACTCCTGA They wish to grow people As if they were crops To be harvested. ATGGTGCACCTGACTCCTGA A cloned or genetically modified human Is still a human— And humans have rights. ATGGTGCACCTGACTCCTGA A person is not a product Regardless of whether They're homegrown or GMO. ATGGTGCACCTGACTCCTGA Perhaps two keys are better than one button. Maybe marriage is a security clearance. Footnote: ATGGTGCACCTGACTCCTGA is part of the human DNA sequence.


